Estradiol induces osteoprotegerin expression by human dental pulp cells

Jeeranan Manokawinchoke • Patcharee Ritprajak • Thanaphum Osathanon • Prasit Pavasant

Received: 9 May 2014 / Accepted: 6 September 2014 ti The Society of The Nippon Dental University 2014

Abstract Estrogen deficiency is associated with increased inflammation related periapical bone resorption. The present study aimed to evaluate the effect and intra- cellular mechanism(s) of estrogen on osteoprotegerin (OPG) and receptor activator of nuclear factor jB ligand (RANKL) expression in human dental pulp cells (HDPs). HDPs were treated with estradiol at a concentration of 0.1–10 lM. The results showed that estradiol induced OPG expression at both the mRNA and protein levels in a dose- dependent manner. However, no influence on RANKL expression was observed. An estrogen receptor (ER) inhibitor failed to attenuate the estradiol-induced OPG expression. Furthermore, ER-a and ER-b agonists did not simulate estradiol’s effects on OPG expression by HDPs. However, a significant OPG upregulation was observed in HDPs treated with an estradiol-BSA conjugate or a GPR30 agonist. An ERK inhibitor significantly enhanced estradiol- induced OPG expression, whereas a p38 inhibitor markedly attenuated this expression. In conclusion, OPG expression by HDPs may be regulated by estradiol binding a mem- brane receptor and the balance between the ERK and p38 signaling pathways.
Keywords Human dental pulp cells ti Estrogen ti OPG RANKL ti

Introduction

The role of estrogen in hard tissue homeostasis is well known. Postmenopausal women, who lack estrogen, are affected by osteoporosis [1]. In addition, the role of estrogen in men has been reported. In men, the enzyme aromatase can convert testosterone to estradiol [2], which has been shown to influence body composition, strength, and sexual function [2]. In addition, estrogen deficient animals have been found to have a significant increase in periapical bone resorption [3]. Correspondingly, periapical lesions in ovariectomized rats demonstrated a significant increase in receptor activator of nuclear factor jB ligand (RANKL)-positive cells [4]. Thus, estrogen may regulate hard tissue destruction in tooth-related areas.
Two forms of the estrogen receptor (ER-a and ER-b) have been identified in human dental pulp cells (HDPs) [5]. Estrogen has been shown to promote the osteo/odontogenic differentiation of dental pulp cells [6]. Together, these results suggest the influence of estrogen in dental and

J. Manokawinchoke ti P. Ritprajak ti T. Osathanon ti P. Pavasant Mineralized Tissue Research Unit, Faculty of Dentistry, Chulalongkorn University, Bangkok, Thailand

J. Manokawinchoke ti T. Osathanon ti P. Pavasant (&) Department of Anatomy, Faculty of Dentistry, Chulalongkorn University, Henri-Dunant Rd., Pathumwan, Bangkok 10330, Thailand
e-mail: [email protected] P. Ritprajak
Department of Microbiology and Immunology, and DRU in Oral Microbiology, Faculty of Dentistry, Chulalongkorn University, Bangkok, Thailand
periapical tissue homeostasis.
Estradiol, a form of estrogen, stimulated osteoprotegerin (OPG) expression and decreased the expression of RANKL in osteoblasts [7]. OPG and RANKL are molecules that play important roles in osteoclast formation and potentially regulate hard tissue resorption [8]. In inflamed dental pulp tissue, the upregulation of OPG expression was noted [9], implying that OPG is involved in pulp homeostasis. In the present study, we hypothesized that estrogen may partici- pate in pulp homeostasis. Thus, the aim of our study was to investigate the influence of estrogen on OPG and RANKL

1 3

expression in dental pulp cells. The potential regulatory mechanism was also examined.

Materials and methods Cell culture
The human dental pulp cell isolation protocol was approved by the Ethics Committee of the Faculty of Dentistry, Chul- alongkorn University. HDPs were isolated from freshly extracted teeth that were removed according to the treatment plan. Informed consent was obtained from patients prior to extraction. The isolation protocol and culture conditions were performedaspreviouslydescribed[10].Briefly,theteethwere gentlysplitapart and the dentalpulp tissues wereremoved and rinsed in sterilized culture medium. The tissues were minced into small pieces and placed in 35 mm dishes in a humidified atmosphere with 5 % CO2 at 37 tiC and the HDP cells were allowed to migrate from the tissue. The HDP cells were cul- tured until near confluence and then subcultured by trypsini- zed and maintained in Dulbecco’s Modified Eagle Medium (DMEM) containing penicillin (100 unit/mL), streptomycin (100 ug/mL), amphotericin B (250 ng/mL), 2 mM L-gluta- mine(1xGlutamaxti)and10 %FBS.Theculturemediumand supplements were purchased from Gibco (BRL, Carlsbad, CA, USA). The cells were cultured in a humidified atmo- sphere with 5 % CO2 at 37 tiC. Cells from passages 3–6 were used in the study. Cells from three different donors were used.

Cell treatment

HDPs were seeded in 12-well plates (37,500 cells/cm2). The cells were starved in serum free medium for 8 h prior to treatment. The concentrations of the reagents used were 0.1–10 lM 17b-estradiol (Sigma-Aldrich, St. Louis, MO, USA), 2.7 lg/mL 17b-estradiol-BSA (CalBioreagents, San Mateo, CA, USA), 400 pM PPT (an estrogen receptor a agonist; Tocris Bioscience, Bristol, UK), 10 nM ERB 041 (an estrogen receptor b agonist; Tocris Bioscience, Bristol, UK), 0.3 nM ICI 182,780 (an estrogen receptor antagonist; Tocris Bioscience, Bristol, UK), 5 nM G-1 (a GPR30

receptor agonist; Tocris Bioscience, Bristol, UK, 0.26 lM Src Kinase inhibitor I (Calbiochem, San Diego, CA, USA), 1.4 lM LY294002, a phosphatidylinositol 3-kinase (PI3 K) inhibitor (Calbiochem, San Diego, CA, USA), 10 nM NF-jB inhibitor (Calbiochem, San Diego, CA, USA), 2.5 lM ERK inhibitor (Calbiochem, San Diego, CA, USA), and 5.2 lM SB 203580 (a p38 kinase inhibitor; (Calbiochem, San Diego, CA, USA).

Cell viability test

Cell viability analysis was performed using the MTT assay as previously described [11]. Briefly, the cells were incu- bated in the MTT (3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide) solution for 15 min. Sub- sequently, the formazan crystals were dissolved in a buffer composed of glycine (0.1 M), sodium chloride (0.1 M), and DMSO at pH 10. Absorbance was measured at 570 nm using a microplate reader (Elx800; Biotek, Winooski, VT, USA). The data were normalized to control.

Reverse transcription-polymerase chain reaction (RT-PCR)

Total RNA was extracted using Isol-RNA Lysis Reagent (5 PRIME, Gaithersburg, MD, USA). RT-PCR was performed as previously described [9]. Briefly, one microgram of each RNA sample was converted to cDNA using reverse trans- criptase (Promega, Madison, WI, USA). The polymerase chain reaction was performed in a thermocycling machine (BiometraGmH, Go¨ttingen, Germany) using Taq polymer- ase (Invitrogen, Eugene, OR, USA). The primers’ sequences are shown in Table 1 [12–14]. The annealing temperature was 60 ti C. The PCR products were electrophoresed on 1.8 % agarose gel and stained with ethidium bromide.

Enzyme-linked immunosorbent assay (ELISA)

The secreted OPG protein was measured using a Human Osteoprotegerin/TNFRSF11B DuoSet kit (catalog no: DY805,R and D Systems,Minneapolis,MN, USA)according to the manufacturer’s instructions. The capture antibody and

Table 1 Primer sequences
Gene (Accession No) Forward sequence Reverse sequence Cycles
Estrogen receptor a (NM_000125) 50 AACACAAGCGCCAGAGAGAT30 50 GATCTCCACCATGCCCTCTA30 40
Estrogen receptor b (NM_001437.2) 50 TGAAAAGGAAGGTTAGTGGGAACC30 50 TGGTCAGGGACATCATCATGG30 40
RANKL (NM_033012.2) 50 CCAGCATCAAAATCCCAAGT30 50 CCCCTTCAGATGATCCTTC30 32
OPG (NM_002546.3) 50 TCAAGCAGGAGTGCAATCG30 50 AGAATGCCTCCTCACACAGG30 24
GAPDH (NM_002046.3) 50 TGAAGGTCGGAGTCAACGGAT30 50 TCACACCCATGACGAACATGG30 22

the detection antibody were mouse anti-human OPG and biotinylated goat anti-human OPG, respectively. The absor- bance was determined at 450 nm. The concentration of OPG was calculated using a recombinant human OPG standard curve. The data are presented as the percentage increase of OPG concentration compared to the control.

Western blot analysis

Blotting was performed as previously described [10]. Protein concentrations were determined using a BCA assay kit (Pierce Biotechnology, Rockford, IL, USA). The membrane was incubated with primary antibody overnight. Subsequently, the membranes were incubated with biotin- ylated secondary antibody for 30 min, followed by perox- idase-labeled streptavidin for 30 min. Chemiluminescence (Pierce Biotechnology, Rockford, IL, USA) was used to evaluate the presence of the target protein. The primary antibodies used were mouse anti-human RANKL (dilution 1:300, R and D Systems, Minneapolis, MN, USA), mouse anti-human ACTIN (dilution 1:2000, Chemicon Interna- tional, Billerica, MA, USA), rabbit anti-phospho-ERK1/
ERK2 (dilution 1:2000, R and D Systems, Minneapolis, MN, USA), mouse anti-ERK1/ERK2 (dilution 1:2000, R and D Systems, Minneapolis, MN, USA), rabbit anti- phospho-p38 (dilution 1:1000, R and D Systems, Minne- apolis, MN, USA), mouse anti-p38 (dilution 1:1000, Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA).

Immunocytochemistry staining

The cells were fixed with 4 % formalin and permeabilized with 0.1 % Triton-X100. The cells were incubated with primary antibodies against estrogen receptor a (dilution 1: 250, Chemicon International, Billerica, MA, USA) or estrogen receptor b (dilution 1: 100, Chemicon International, Billerica, MA, USA) at 4 tiC overnight. The specimens were then incubated with biotinylated secondary antibody, fol- lowed by streptavidin-FITC and DAPI. The images were captured using a Zeiss Axio Observer Z1 (Carl Zeiss, Ger- many). The staining protocol was performed omitting the primary antibody as the negative control.

Statistical analysis

The data were presented as mean ± standard deviation and statistically analyzed by one-way analysis of variance (ANOVA) using SPSS software (Chicago, IL, USA). The Scheffe’s test was used for post hoc analysis (significance was set at p \ 0.05).

Results

Estradiol enhanced OPG expression

We began by examining the endogenous expression of ER- a and ER-b in HDPs. We observed the mRNA expression

Fig. 1 Human dental pulp cells expressed estrogen receptors (ER). ER-a and ER-b expression was examined using reverse transcriptase polymerase chain reaction (a) and immunocytochemistry staining (b).

Cell viability was determined using an MTT assay after estradiol treatment for 24 h (c)

of ER-a and ER-b in human dental pulp tissues and HDPs (Fig. 1a). Correspondingly, ER-a and ER-b protein expression was observed in HDPs (Fig. 1b). We found no differences in cell viability after exposing HDPs to estra- diol at concentrations ranging from 0.1 to 10 lM for 24 h (Fig. 1c). Furthermore, OPG mRNA and protein levels increased in a dose-dependent manner upon estradiol stimulation (Fig. 2a, b). However, estradiol did not enhance RANKL expression at either the mRNA or protein level (Fig. 2a, c). The upregulation of OPG but not RANKL expression in HPDs treated with estradiol resulted in a dose-dependent increase in the OPG/RANKL ratio. However, only the groups treated with estradiol at con- centrations of 1 and 10 lM demonstrated a statistically significant release of OPG protein release. Thus, estradiol

at a concentration of 10 lM was used in subsequent experiments.

A membrane receptor, not ER, is involved in estradiol- induced OPG expression

Blocking the ER with ICI 182780 did not attenuate the estradiol-induced OPG expression at the mRNA or protein levels (Fig. 3a, b). In addition, neither the ER-a agonist nor the ER-b agonist stimulated OPG expression at the mRNA or protein levels (Fig. 3c, d).
We used estradiol-BSA, which cannot pass through the cell membrane, to investigate if a membrane receptor was involved in the estradiol-induced OPG expression. The results demonstrated that both estradiol and estradiol-BSA enhanced OPG mRNA and protein expression (Fig. 4a, b). No differ- ences in RANKL mRNA expression was observed under either condition. Correspondingly, OPG mRNA and protein expression were upregulated by a GPR30 agonist, similar to treatment with estradiol (Fig. 4c, d). These results suggest the role of a membrane-bound receptor in estradiol-induced OPG expression.

ERK and p38 contributed to estradiol-induced OPG expression

To determine the potential intracellular signaling pathway of estradiol signaling, various pathway inhibitors were employed. HDPs were pretreated with each inhibitor before estradiol treatment. The results showed that the Src, PI3 K, and NF-jB inhibitors did not alter the estradiol-induced OPG expression (Fig. 5a). Interestingly, pretreatment with the ERK inhibitor resulted in an additional upregulation of OPG expression, however, the p38 inhibitor attenuated this expression (Fig. 5b, c). Combined pretreatment with ERK inhibitor and p38 inhibitor had similar effects to that of pretreatment with p38 inhibitor alone (Fig. 5b, c), implying a regulatory role for p38.
We also evaluated the phosphorylation levels of ERK and p38. Phosphorylated ERK and p38 were noted at 15 min after estradiol treatment and phosphorylation levels decreased thereafter (Fig. 6a). The p38 and ERK phosphorylation levels were attenuated by pretreatment with a p38 inhibitor and an ERKinhibitor,respectively(Fig. 6b).Theseresultsconfirmed the contribution of p38 and ERK signaling to estradiol sig- naling in HDPs. We also found that that p38 inhibition in estradiol-treated HDPs resulted in increased ERK phosphor- ylation compared to the control (Fig. 6b). However, ERK

Fig. 2 Estradiol induced OPG expression in human dental pulp cells (HDPs). HDPs were treated with estradiol for 24 h. OPG and RANKL mRNA expression (a). OPG and RANKL protein expression was determined using an enzyme-linked immunosorbent assay (b) and western blot analysis (c), respectively. Asterisk indicates a significant difference compared to the control
inhibition did not influence p38 phosphorylation levels (Fig. 6b). Thus, the balance between p38 and ERK signaling may play a role in estradiol-induced OPG expression.
To evaluate the mechanism of a membrane-bound receptor in estradiol-treated HPDs, HDPs were treated with

Fig. 3 Estrogen receptor (ER) agonists did not stimulate OPG expression in human dental pulp cells (HDPs). HDPs were treated with either estradiol, an ER-a agonist, or ER-b agonist for 24 h. In the ER inhibition experiment, HDPs were pretreated with an ER antagonist (ICI 182780) for
30 min. OPG and RANKL mRNA expression was determined using reverse transcriptase polymerase chain reaction (a, c). OPG protein expression was evaluated using an enzyme-linked immunosorbent assay (b, d). Asterisk indicates a significant difference compared to the control

Fig. 4 GPR30 agonist induced OPG expression in human dental pulp cells (HDPs). HDPs were treated with either estradiol, estradiol-BSA, an ER- a agonist, an ER-b agonist, or a GPR30 agonist for 24 h. OPG and RANKL mRNA expression was determined using reverse transcriptase polymerase chain reaction (a, c). OPG protein expression was examined using an enzyme-linked immunosorbent assay (b, d). Asterisk indicates a significant difference compared to the control

finding that estradiol increased the expression of OPG but not that of RANKL We also found that the estradiol- induced OPG expression occurred via a membrane-bound receptor, not through ER-a or ER-b. OPG and RANKL have been demonstrated to be associated with periapical bone loss. When stimulated with a polymicrobial biofilm, dental pulp cells exhibited a lower OPG/RANKL ratio than did periodontal ligament cells [15]. The increase of OPG expressing cells in metformin treatment was related to the attenuation of periapical bone loss [16]. The pro-inflam- matory cytokines IL1-a and TNF-a stimulated RANKL but decreased OPG expression in human dental pulp cells [17]. In the primary dentition, the OPG/RANKL ratio in the dental pulp regulates physiological root resorption [18]. However, the role of the OPG/RANKL ratio in the dental pulp of permanent teeth is unresolved. The specific func- tion of the OPG/RANKL ratio in the destruction of dental pulp and periapical tissues is unclear due to the limited numbers of studies [19]. In addition, the OPG/RANKL ratio was not carefully evaluated in these studies [19]. However, the OPG/RANKL ratio may contribute to the regulation of hard tissue destruction in periapical lesions and internal resorption.
A difference in periapical bone loss has been observed
between male and female mice. Male mkp-1-/- mice

Fig. 5 ERK and p38 signaling pathways are involved in estradiol- induced OPG expression. OPG protein expression was determined after treating human dental pulp cells with estradiol in the presence of various signaling inhibitors (a). OPG and RANKL mRNA expression was determined using reverse transcriptase polymerase chain reaction (b). e OPG protein expression was examined using an enzyme-linked immu- nosorbentassay(c). Bars indicateasignificant differencebetweengroups

a GPR30 agonist and the p38 and ERK phosphorylation levels were evaluated. The results illustrated that the GPR30 agonist induced an increase in p38 and ERK phosphorylation levels at 15 min and the phosphorylation levels subsequently decreased (Fig. 7). These results were similar to those of HDPs treated with estradiol, implying the participation of membrane-bound receptor signaling in estradiol-induced OPG expression by HDPs.

Discussion

In the present study, we investigated the influence of estradiol on OPG and RANKL expression by HDPs,
exhibited significantly greater periapical bone loss than that of mkp-1-/- female mice [20], suggesting the potential role of sex hormones in the regulation of periapical bone destruction. In addition, estrogen deficient rats had signif- icantly higher periapical bone resorption when compared to normal rats [3]. Moreover, RANKL-positive cells were prevalent in the periapical lesions of ovariectomized rats [4]. These findings are consistent with our study where estradiol treatment resulted in the increase of OPG expression. Although the RANKL expression was not altered, the OPG/RANKL ratio increased. In addition to its role in regulating the OPG/RANKL ratio, estrogen levels have been shown to be correlated to dental pulp micro- circulation in women [21], with high serum estradiol levels associated with high pulpal blood flow. Conversely, post- menopausal and menstruating women had low pulpal blood flow. It was also reported that in men, oral supplementation with testosterone resulted in an increase of serum estradiol in a dose-dependent manner [2]. Although the effect of estradiol on hard tissue in men is still unclear, increased serum estradiol in men resulted in an increase in body fat accumulation and decreased sexual function [2]. Our finding suggests that estrogen may have a protective role on hard tissue and participates in the homeostasis of dental pulp and periapical tissues.
Estrogen has been shown to activate its intracellular signaling via binding with the classical steroid receptors (ER-a and ER-b) or G protein-coupled receptors [22]. ER-

Fig. 6 p38 inhibitor enhanced ERK phosphorylation in estradiol- treated human dental pulp cells (HDPs). The phosphorylation levels of ERK and p38 were determined using western blot analysis after estradiol treatment (a). HDPs were treated with estradiol in the

presence or absence of the p38 inhibitor or the ERK inhibitor. The phosphorylation levels of ERK and p38 at different time points were determined using western blot analysis (b)

Fig. 7 GPR30 agonist induced p38 and ERK phosphorylation in human dental pulp cells (HDPs). HDPs were treated with a GPR30 agonist and the phosphorylation levels of p38 and ERK were determined using western blot analysis at various time points after treatment

a and ER-b are both expressed in human dental pulp cells (HDPs) [5], and ER-a has been detected in human dental pulp tissues [23]. This is in accordance with our results that human dental pulp tissues and cells expressed both ER-a and ER-b at the mRNA level. ER-a and ER-b protein expression was also present in HDPs. We also observed that HDPs expressed GPR30 mRNA (data not shown).

These data imply that HDPs may respond to estradiol stimulation via the classical steroid receptors or G protein- couple receptors.
One limitation of the present study is that we did not have information on the sex of the donors of the cells and tissues due to ethical constraints. It has been previously reported that ER-a was expressed in both male and female HDPs [5]. Studies have shown that there is no correlation between estrogen receptor expression and sex differences in thyroid sections of Graves’ disease subjects and nodular goiter as well as pulmonary neuroendocrine tumors [24, 25]. However, a study has shown that female-derived HDPs exhibited higher levels of ER expression compared to those of the male-derived cells [5]. Thus, the differential ER expression and function based on the donor’s sex should be further investigated.
Estrogen binds to ERs and regulates gene expression [26]. In the present study, ER-a and ER-b agonists did not stimulate OPG expression. Correspondingly, ER inhibition did not diminish the estradiol effect. These data indicate that ER-a and ER-b did not participate in estradiol-induced OPG expression in HDPs. Thus, we hypothesized that this effect might occur via a membrane receptor. We used

estradiol-BSA, a cell impermeable form of estradiol, to investigate this hypothesis. Interestingly, estradiol-BSA enhanced OPG expression similar to that of estradiol in HDPs, implying the role of a membrane receptor in estradiol signaling. It has been reported that the non- genomic effects of estradiol occurred via a G-protein- coupled protein or membrane-associated receptor [27, 28].
The present study demonstrated that estradiol upregu- lated the phosphorylation levels of ERK and p38. Previous studies using various cell types also reported that estradiol signaling was regulated via the ERK and p38 signaling pathways. For example, ERK and p38 involvement was shown in the estradiol-induced reduction in apoptosis in skeletal muscle cells [29, 30]. In contrast, it was previously reported that estradiol promoted the osteo/odontogenic differentiation of human dental pulp stem cells via acti- vation of NF-jB [6]. However, we did not observe the involvement of NF-jB in our study. Notably, we found that GPR30 agonist treatment resulted in increased phosphor- ylation levels of ERK and p38. In accordance with our results, it has been reported that GPR30 regulates gene expression in response to estrogen stimulation via the GPR30/EGFR/ERK signaling pathway [31]. These data imply that estradiol activates its intracellular signaling via binding to a membrane-associated receptor.
Our study revealed that ERK inhibition increased the estradiol-induced OPG expression, but p38 inhibition attenuated this expression. Moreover, p38 inhibition resulted in increased ERK phosphorylation levels. These results imply that the balance between ERK and p38 signaling is involved in the mechanism(s) of estradiol-induced OPG expression in HDPs. It has been shown that p38 inhibition resulted in the attenuation of P. gingivalis-induced RANKL, but not OPG, in bone marrow stromal cells, implying the existence of different regulatory mechanisms [32]. Thus, our study revealed a potential estradiol regulating mechanism in HDPs. Further investigation into the role of OPG in dental pulp in addition to osteoclastogenesis regulation should be further investigated.
In summary, the present study has shown that estrogen enhanced OPG expression in human dental pulp cells. Interestingly, the mechanism involved membrane-bound receptors rather than the typical estrogen receptors. The regulation of OPG/RANKL expression in HDPs by estra- diol could be translated into a clinical treatment. The application of an estrogen-like substance in the dental pulp tissues may increase the OPG/RANKL ratio and attenuate bone resorption. Correspondingly, it has previously been shown that estradiol participated in the odonto/osteogenic differentiation by human dental pulp cells [6, 33]. In addition, phytoestrogen was utilized in several clinical trials in postmenopausal women, resulting in positive clinical outcomes [34, 35]. Thus, estradiol may be a

candidate chemical agent for the potential application in dental treatment. However, this hypothesis requires further investigation.

Acknowledgments This study was supported by ‘Integrated Inno- vation Academic Center: IIAC’ Chulalongkorn University Centenary Academic Development Project and the Research Chair Grant 2012, the National Science and Technology Development Agency (NSTDA).

Conflict of interest All authors declare no conflicts of interest in the present study.

References

1.Balasch J. Sex steroids and bone: current perspectives. Hum Reprod Update. 2003;9:207–22.
2.Finkelstein JS, Lee H, Burnett-Bowie SM, Pallais JC, Yu EW, Borges LF, Barry CV, Wulczyn KE, Thomas BJ, Leder BZ. Gonadal steroids and body composition strength, and sexual function in men. N Engl J Med. 2013;369:1011–22.
3.Gilles JA, Carnes DL, Dallas MR, Holt SC, Bonewald LF. Oral bone loss is increased in ovariectomized rats. J Endod. 1997;23:419–22.
4.Zhang X, Peng B, Fan M, Bian Z, Chen Z. The effect of estrogen deficiency on receptor activator of nuclear factor kappa B ligand and osteoprotegerin synthesis in periapical lesions induced in rats. J Endod. 2007;33:1053–6.
5.Inaba T, Kobayashi T, Tsutsui TW, Ogawa M, Uchida M, Tsutsui T. Expression status of mRNA for sex hormone receptors in human dental pulp cells and the response to sex hormones in the cells. Arch Oral Biol. 2013;58:943–50.
6.Wang Y, Zheng Y, Wang Z, Li J, Wang Z, Zhang G, et al. 10(-7) m 17beta-oestradiol enhances odonto/osteogenic potency of human dental pulp stem cells by activation of the NF-kappaB pathway. Cell Prolif. 2013;46:677–84.
7.Bord S, Ireland DC, Beavan SR, Compston JE. The effects of estrogen on osteoprotegerin, RANKL, and estrogen receptor expression in human osteoblasts. Bone. 2003;32:136–41.
8.Boyce BF, Xing L. Functions of RANKL/RANK/OPG in bone modeling and remodeling. Arch Biochem Biophys. 2008;473:139–46.
9.Kuntz KA, Brown CE Jr, Legan JJ, Kafrawy AH. An immuno- histochemical study of osteoprotegerin in the human dental pulp. J Endod. 2001;27:666–9.
10.Srisawasdi S, Pavasant P. Different roles of dexamethasone on transforming growth factor-beta1-induced fibronectin and nerve growth factor expression in dental pulp cells. J Endod. 2007;33:1057–60.
11.Muincharern W, Louwakul P, Pavasant P, Lertchirakarn V. Effect of fluocinolone acetonide on human dental pulp cells: cytotox- icity, proliferation, and extracellular matrix formation. J Endod. 2011;37:181–4.
12.Kim IY, Kim BC. Seong do H. Raloxifene, a mixed estrogen agonist/antagonist, induces apoptosis in androgen-independent human prostate cancer cell lines. Cancer Res. 2002;62:5365–9.
13.Lee SI, Kim GT, Kim HJ, Park SH, Kim EC. NOD2 mediates odontoblast differentiation and RANKL expression. J Dent Res. 2014;93:678–84.
14.Zhang D, Yang YQ, Li XT, Fu MK. The expression of osteopro- tegerin and the receptor activator of nuclear factor kappa B ligand in human periodontal ligament cells cultured with and without 1alpha,25-dihydroxyvitamin D3. Arch Oral Biol. 2004;49:71–6.

15.Belibasakis GN, Meier A, Guggenheim B, Bostanci N. Oral biofilm challenge regulates the RANKL-OPG system in peri- odontal ligament and dental pulp cells. Microb Pathog. 2011;50:6–11.
16.Liu L, Zhang C, Hu Y, Peng B. Protective effect of metformin on periapical lesions in rats by decreasing the ratio of receptor activator of nuclear factor kappa B ligand/osteoprotegerin. J En- dod. 2012;38:943–7.
17.Kim YS, Min KS, Lee HD, Oh HW, Kim EC. Effect of cytosolic phospholipase A2 on proinflammatory cytokine-induced bone resorptive genes including receptor activator of nuclear factor kappa B ligand in human dental pulp cells. J Endod. 2010;36:636–41.
18.Zhu Y, Shang L, Chen X, Kong X, Liu N, Bai Y, et al. Deciduous dental pulp stem cells are involved in osteoclastogenesis during physiologic root resorption. J Cell Physiol. 2013;228:207–15.
19.Belibasakis GN, Rechenberg DK, Zehnder M. The receptor activator of NF-kappaB ligand-osteoprotegerin system in pulpal and periapical disease. Int Endod J. 2013;46:99–111.
20.McAbee J, Li Q, Yu H, Kirkwood KL. Sexual dimorphism in periapical inflammation and bone loss from mitogen-activated protein kinase phosphatase-1 deficient mice. J Endod. 2012;38:1097–100.
21.Dzeletovic B, Grga D, Krsljak E, Stratimirovic D, Brkovic B, Stojic D. Dental pulp blood flow and its oscillations in women with different estrogen status. J Endod. 2012;38:1187–91.
22.Prossnitz ER, Arterburn JB, Smith HO, Oprea TI, Sklar LA, Hathaway HJ. Estrogen signaling through the transmembrane G protein-coupled receptor GPR30. Annu Rev Physiol. 2008;70:165–90.
23.Jukic S, Prpic-Mehicic G, Talan-Hranilovc J, Miletic I, Segovic S, Anic I. Estrogen receptors in human pulp tissue. Oral Surg Oral Med Oral Pathol Oral Radiol Endod. 2003;95:340–4.
24.Domoslawski P, Podhorska-Okolow M, Pula B, Lukienczuk T, Dziegiel P. Expression of estrogen and progesterone receptors and Ki-67 antigen in graves’ disease and nodular goiter. Folia Histochem Cytobiol. 2013;51:135–40.
25.Sica G, Wagner PL, Altorki N, Port J, Lee PC, Vazquez MF, Saqi A. Immunohistochemical expression of estrogen and

progesterone receptors in primary pulmonary neuroendocrine tumors. Arch Pathol Lab Med. 2008;132:1889–95.
26.Stevis PE, Deecher DC, Suhadolnik L, Mallis LM, Frail DE. Differential effects of estradiol and estradiol-BSA conjugates. Endocrinology. 1999;140:5455–8.
27.Schwartz N, Chaudhri RA, Hadadi A, Schwartz Z, Boyan BD. 17Beta-estradiol promotes aggressive laryngeal cancer through membrane-associated estrogen receptor-alpha 36. Horm Cancer. 2014;5:22–32.
28.Sylvia VL, Walton J, Lopez D, Dean DD, Boyan BD, Schwartz Z. 17 beta-estradiol-BSA conjugates and 17 beta-estradiol regu- late growth plate chondrocytes by common membrane associated mechanisms involving PKC dependent and independent signal transduction. J Cell Biochem. 2001;81:413–29.
29.Ronda AC, Vasconsuelo A, Boland R. Extracellular-regulated kinase and p38 mitogen-activated protein kinases are involved in the antiapoptotic action of 17beta-estradiol in skeletal muscle cells. J Endocrinol. 2010;206:235–46.
30.Ronda AC, Buitrago C, Boland R. Role of estrogen receptors, PKC and Src in ERK2 and p38 MAPK signaling triggered by 17beta-estradiol in skeletal muscle cells. J Steroid Biochem Mol Biol. 2010;122:287–94.
31.Prossnitz ER, Maggiolini M. Mechanisms of estrogen signaling via GPR30. Mol Cell Endocrinol. 2009;308:32–8.
32.Reddi D, Brown SJ, Belibasakis GN. Porphyromonas gingivalis induces RANKL in bone marrow stromal cells: involvement of the p38 MAPK. Microb Pathog. 2011;51:415–20.
33.Wang Y, Yan M, Yu Y, Wu J, Yu J, Fan Z. Estrogen deficiency inhibits the odonto/osteogenic differentiation of dental pulp stem cells via activation of the NF-kappaB pathway. Cell Tissue Res. 2013;352:551–9.
34.Scuderi G, Contestabile MT, Gagliano C, Iacovello D, Scuderi L, Avitabile T. Effects of phytoestrogen supplementation in post- menopausal women with dry eye syndrome: a randomized clin- ical trial. Can J Ophthalmol. 2012;47:489–92.
35.Yang TS, Wang SY, Yang YC, Su CH, Lee FK, Chen SC, et al. Effects of standardized phytoestrogen on Taiwanese menopausal women. Taiwan J Obstet Gynecol. 2012;51:229–35.